eccDNAMamba
A Pre-Trained Model for Ultra-Long eccDNA Sequence Analysis
Model Overview
eccDNAMamba is a bidirectional state-space model (SSM) designed for efficient and topology-aware modeling of extrachromosomal circular DNA (eccDNA).
By combining forward and reverse Mamba-2 encoders, motif-level Byte Pair Encoding (BPE), and a lightweight head–tail circular augmentation, it captures wrap-around dependencies in ultra-long (10–200 kbp) genomic sequences while maintaining linear-time scalability.
The model provides strong performance across cancer-associated eccDNA prediction, copy-number level estimation, and real vs. pseudo-eccDNA discrimination tasks.
Quick Start
from transformers import AutoTokenizer, AutoModelForMaskedLM
tokenizer = AutoTokenizer.from_pretrained("eccdna/eccDNAMamba-1M")
model = AutoModelForMaskedLM.from_pretrained("eccdna/eccDNAMamba-1M")
sequence = "ATGCGTACGTTAGCGTACGT"
inputs = tokenizer(sequence, return_tensors="pt")
outputs = model(**inputs)
# Access logits or reconstruct masked spans
logits = outputs.logits
Citation
@inproceedings{
liu2025eccdnamamba,
title={ecc{DNAM}amba: A Pre-Trained Model for Ultra-Long ecc{DNA} Sequence Analysis},
author={Zhenke Liu and Jien Li and Ziqi Zhang},
booktitle={ICML 2025 Generative AI and Biology (GenBio) Workshop},
year={2025},
url={https://openreview.net/forum?id=56xKN7KJjy}
}
- Downloads last month
- 4
Inference Providers NEW
This model isn't deployed by any Inference Provider. 🙋 Ask for provider support
Model tree for eccDNAMamba/eccDNAMamba_real_vs_pseudo_eccdna_arabidopsis_thaliana
Base model
eccDNAMamba/eccDNAMamba-1M